Sequence ID | >WENV170645345 |
Genome ID | JMSV01000521 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 4031 |
End posion on genome | 3947 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aatatatagt |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGCCAAAGGGAACAGACTGTAAATCTGTCGGCAACGCCTTCGGA |
Downstream region at tRNA end position |
ctacttttga |
Secondary structure (Cloverleaf model) | >WENV170645345 Tyr GTA t ACCA ctacttttga G - C G - C T - A G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | G G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCAACGCCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |