Sequence ID | >WENV170645360 |
Genome ID | JMSV01000834 |
Phylum/Class | [JMSV] bioreactor metagenome; Culture-2 Bioreactor Bmz derived from microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 573 |
End posion on genome | 659 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gacacctcat |
tRNA gene sequence |
GCCGAGGTGGTGGAACTGGTAGACACGCTGTCTTGAGGGGGCAGTGGAAGAGATTCCGTG |
Downstream region at tRNA end position |
tgaagattaa |
Secondary structure (Cloverleaf model) | >WENV170645360 Leu GAG t ACCA tgaagattaa G - C C - G C - G G - C A - T G - C G - C T A T C C C C C A C A A G | | | | | G T G G T G G G G G G C G | | | T T G A C A C T A G G TGGAAGAGATTCCGT C - G T - A G - C T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |