Sequence ID | >WENV170645514 |
Genome ID | JNSK01000041 |
Phylum/Class | [JNSK] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 25307 |
End posion on genome | 25234 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gtctttctat |
tRNA gene sequence |
GGTGGAATGGCCGAGAGGCGAGGCAAGGGACTGCAAATCCCTCTACACGGGTTCAAATCC |
Downstream region at tRNA end position |
ttatttaaaa |
Secondary structure (Cloverleaf model) | >WENV170645514 Cys GCA t TCCA ttatttaaaa G - C G - C T - A G - C G - C A - T A - T T A T T G C C C A G A G | | | | | A A G C C G A C G G G C G | | | T T G A G G C C G A CTAC A - T G - C G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |