Sequence ID | >WENV170645522 |
Genome ID | JNSK01000046 |
Phylum/Class | [JNSK] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 14247 |
End posion on genome | 14161 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agaacatctc |
tRNA gene sequence |
GTCCGGGTGGCGGAATTGGCAGACGCGCTAGCTTGAGGTGCTAGTGCCCGCAAGGGCTTC |
Downstream region at tRNA end position |
tcgattattt |
Secondary structure (Cloverleaf model) | >WENV170645522 Leu GAG c ACGA tcgattattt G - C T - A C - G C - G G - C G + T G + T T G T G C C C C A T A A G | | | | | A T G G C G C G G G G C G | | | T T G A C G C C A G G TGCCCGCAAGGGCTT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |