Sequence ID | >WENV170645533 |
Genome ID | JNSK01000079 |
Phylum/Class | [JNSK] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 10356 |
End posion on genome | 10441 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cctctcctac |
tRNA gene sequence |
GGAGGGCTCGCATAGCGGCCGAGTGCACCGGTCTTGAAAACCGGCAGGTGAAAGCCTCGT |
Downstream region at tRNA end position |
gttttatttt |
Secondary structure (Cloverleaf model) | >WENV170645533 Ser TGA c GCCA gttttatttt G - C G - C A - T G - C G - C G - C C - G T A T C A C C C A C G A C | | | | | A G T A C G G T G G G C G + | | | T T C G T G C C G A A CAGGTGAAAGCCTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |