Sequence ID | >WENV170645556 |
Genome ID | JNSK01000138 |
Phylum/Class | [JNSK] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 12819 |
End posion on genome | 12734 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gatcccgcca |
tRNA gene sequence |
GGAGGATTCGCATAGCGGCCGAGTGCGCACGCTTGGAAAGCGTGTAAAGGGCAACCTTTC |
Downstream region at tRNA end position |
atttcattcg |
Secondary structure (Cloverleaf model) | >WENV170645556 Ser GGA a GCtc atttcattcg G - C G - C A - T G - C G - C A - T T - A T A T C T C C C A C G A C | | | | | A G T A C G G A G G G C G + | | | T T C G T G C C G A G TAAAGGGCAACCTTTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |