Sequence ID | >WENV170645578 |
Genome ID | JNSL01000001 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 83677 |
End posion on genome | 83592 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tacaagtcac |
tRNA gene sequence |
GTCCGGGTGGCGGAATGGTAGACGCGCTAGCTTGAGGTGTTAGTCCTCGCAAGGGGGTAG |
Downstream region at tRNA end position |
atcaatgaac |
Secondary structure (Cloverleaf model) | >WENV170645578 Leu GAG c ACAA atcaatgaac G - C T - A C - G C - G G - C G + T G - C T G T T C C C C A T A A G | | | | | A G G G C G A G G G G C G | | | T T T A C G C A G G TCCTCGCAAGGGGGT C - G T - A A - T G + T C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |