Sequence ID | >WENV170645589 |
Genome ID | JNSL01000010 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 1482 |
End posion on genome | 1576 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gagagttctc |
tRNA gene sequence |
GGAGACGTCGCATAGCCCGGTCGAGTGCGCCTCACTGCTAATGAGGTAGGGGTTTTAAAA |
Downstream region at tRNA end position |
gtaaaccatt |
Secondary structure (Cloverleaf model) | >WENV170645589 Ser GCT c GCCA gtaaaccatt G - C G - C A - T G - C A - T C - G G - C T A T T C T C C A C C G A C + | | | | A C T A C G G G A G G C G + | | | T T G G T G C T C G A G TAGGGGTTTTAAAAGCCCCTC C - G C - G T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |