Sequence ID | >WENV170645592 |
Genome ID | JNSL01000011 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 1504 |
End posion on genome | 1417 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaaacgattt |
tRNA gene sequence |
GGCGAGGTGGCAGAGCGGCCGAATGCGGGCGCCTTGAAAGCGTCTGAGGTGTAAAAGCCT |
Downstream region at tRNA end position |
taaaagtgct |
Secondary structure (Cloverleaf model) | >WENV170645592 Ser TGA t GCag taaaagtgct G - C G - C C - G G - C A - T G - C G - C T A T C T C C C A C G A G | + | | | A G G A C G G G G G G C G | | | T T C A T G C C G A G TGAGGTGTAAAAGCCTCC G - C G + T C - G G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |