Sequence ID | >WENV170645600 |
Genome ID | JNSL01000019 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 21608 |
End posion on genome | 21519 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gttacatttt |
tRNA gene sequence |
GGAGGGCTCGCCTAGTGGCCGATGGCACCGGTCTTGAAAACCGGAAGGGGTTCACGCTCC |
Downstream region at tRNA end position |
aagcagagat |
Secondary structure (Cloverleaf model) | >WENV170645600 Ser TGA t GCCA aagcagagat G - C G - C A - T G - C G - C G - C C - G T A T C A C C C A T G A C | | | | | A G T C C G G T G G G C G | | | T T C T G G C C G A A AAGGGGTTCACGCTCCTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |