Sequence ID | >WENV170645601 |
Genome ID | JNSL01000019 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 21461 |
End posion on genome | 21371 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcgtttctca |
tRNA gene sequence |
GGAGGCGTCGCCTAGCCCGGTCCATGGCACCCGCCTGCTAAGTGGGAGGGGGTGAAAACC |
Downstream region at tRNA end position |
taaccaatag |
Secondary structure (Cloverleaf model) | >WENV170645601 Ser GCT a GCac taaccaatag G - C G - C A - T G - C G - C C - G G - C T A T C T C C C A C C G A C | | | | | A C T C C G G A G G G C G | | | T T G T G G C T C C A A AGGGGGTGAAAACCTCCAC C - G C - G C - G G + T C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |