Sequence ID | >WENV170645607 |
Genome ID | JNSL01000025 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 23350 |
End posion on genome | 23436 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcaacaccac |
tRNA gene sequence |
GTCGAAGTGGCGGAATAGGCAGACGCGCTAGCTTGAGGGGCTAGTGATCGTAAGATCGTG |
Downstream region at tRNA end position |
aggtttctag |
Secondary structure (Cloverleaf model) | >WENV170645607 Leu GAG c ACCA aggtttctag G - C T - A C - G G - C A - T A - T G - C T G T C C C C C A T A A G | | | | | A A G G C G G G G G G C G | | | T T G A C G C C A G G TGATCGTAAGATCGT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |