Sequence ID | >WENV170645610 |
Genome ID | JNSL01000038 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 9466 |
End posion on genome | 9555 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tcttgatctc |
tRNA gene sequence |
GGTATCGTGTCCGAGCGGCCGAAGGTGCAACTCTCGAAAAGTTGTGTGCGTGTAAGCGCA |
Downstream region at tRNA end position |
cgcaaaacct |
Secondary structure (Cloverleaf model) | >WENV170645610 Ser CGA c GCCA cgcaaaacct G - C G - C T - A A - T T - A C - G G - C T A T C A C C C A C G A G | | | | | A G G C C T G T G G G C G | | T T C A G G T C G A G TGTGCGTGTAAGCGCACC C - G A - T A - T C - G T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |