Sequence ID | >WENV170645613 |
Genome ID | JNSL01000046 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 1100 |
End posion on genome | 1015 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctcgtcaac |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCTTGGAAAGCGAGTTGGGTGAAAGCCCTC |
Downstream region at tRNA end position |
aaaggaagac |
Secondary structure (Cloverleaf model) | >WENV170645613 Ser GGA c GCgc aaaggaagac G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | A G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTGAAAGCCCTC C - G T - A C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |