Sequence ID | >WENV170645615 |
Genome ID | JNSL01000054 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 17178 |
End posion on genome | 17087 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccccacactt |
tRNA gene sequence |
GGAGACGTCGCATAGCCCGGTCGAGTGCGCCTCACTGCTAACGAGGTAAGGGGTTAAACC |
Downstream region at tRNA end position |
cgtttatttt |
Secondary structure (Cloverleaf model) | >WENV170645615 Ser GCT t GCCG cgtttatttt G - C G - C A - T G - C A - T C - G G - C T A T T C C T C A C C G A C | | | | | A C T A C G A G G A G C G + | | | T T G G T G C T C G A G TAAGGGGTTAAACCCTTC C - G C - G T - A C - G A C C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |