Sequence ID | >WENV170645650 |
Genome ID | JNSL01000170 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 736 |
End posion on genome | 651 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gtatctgttc |
tRNA gene sequence |
GCGCGAGTGGCGGAATGGCAGACGCGCTGGCTTCAGGTGCCAGTGCCCGCAAGGGCGTGG |
Downstream region at tRNA end position |
acgataaccc |
Secondary structure (Cloverleaf model) | >WENV170645650 Leu CAG c ACGA acgataaccc G - C C - G G - C C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGCCCGCAAGGGCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |