Sequence ID | >WENV170645656 |
Genome ID | JNSL01000193 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 11001 |
End posion on genome | 11084 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
actaaatcat |
tRNA gene sequence |
GGTAGCTTGCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGTTCACGCCTACAG |
Downstream region at tRNA end position |
tttttggagt |
Secondary structure (Cloverleaf model) | >WENV170645656 Tyr GTA t ACgc tttttggagt G - C G - C T - A A - T G - C C - G T - A T A T T C A C C A T G A G | | | | | A G G C C C A G T G G C G | | | T T C A G G G C A A A CGGTTCACGCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |