Sequence ID | >WENV170645662 |
Genome ID | JNSL01000238 |
Phylum/Class | [JNSL] freshwater metagenome; water column of the freshwater reservoir Embalse de Amadorio in Spain |
Species | |
Start position on genome | 2372 |
End posion on genome | 2457 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtggtaccg |
tRNA gene sequence |
GCCGGAATGGCGGAATGGCAGACGCGGAGCACTCAAAATGCTTTGTTCGAAAGGACGTGT |
Downstream region at tRNA end position |
cgaaactatc |
Secondary structure (Cloverleaf model) | >WENV170645662 Leu CAA g ACCA cgaaactatc G - C C - G C - G G - C G + T A - T A - T T A T C A C C C A T A A G | | | | | A G G G C G G T G G G C G | | | T T C A C G C A G G TGTTCGAAAGGACGT G + T A - T G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |