Sequence ID | >WENV170645906 |
Genome ID | JQGF01000185 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 20256 |
End posion on genome | 20329 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ctccaacagg |
tRNA gene sequence |
GCGGGTGTAGTTTAATGGTAAAACTGATGCTTCCCAAGCATCCGTCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
gttctgcttt |
Secondary structure (Cloverleaf model) | >WENV170645906 Gly CCC g TCCA gttctgcttt G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T T T T G G T G G G C G | | | | T T G A A A C T A T CGTC G - C A - T T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |