Sequence ID | >WENV170645909 |
Genome ID | JQGF01000391 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 110 |
End posion on genome | 194 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcctagccgt |
tRNA gene sequence |
GCCGGTGTGGTGGAATTGGTAGACGCGCCGGACTCAAAATCCGGTTCCGCAAGGAGTGTC |
Downstream region at tRNA end position |
gctgacttca |
Secondary structure (Cloverleaf model) | >WENV170645909 Leu CAA t ACCA gctgacttca G - C C - G C - G G - C G - C T - A G - C T G T C A G C C A T A A G | | | | | G T G G T G G T C G G C G | + | T T G A C G C T A G G TTCCGCAAGGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |