Sequence ID | >WENV170645910 |
Genome ID | JQGF01000505 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 4904 |
End posion on genome | 4828 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttttcttc |
tRNA gene sequence |
GGCGCATTAGCTCAGCAGGTTAGAGCGACGGAATCATAATCCGCAGGTCCCCTGTTCGAA |
Downstream region at tRNA end position |
gaatacccct |
Secondary structure (Cloverleaf model) | >WENV170645910 Met CAT c ACCA gaatacccct G - C G - C C - G G - C C - G A - T T - A T A T G G G A C A C G A A | | | | | G A C T C G C C C T G C G | | | | T T G G A G C T T A G AGGTC A C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |