Sequence ID | >WENV170645912 |
Genome ID | JQGF01000528 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 78 |
End posion on genome | 3 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
actcctgaaa |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCATCGGTTCGAAT |
Downstream region at tRNA end position |
ggnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170645912 Ala TGC a ACCA ggnnnnnnnn G - C G - C G + T G - C C - G C - G T - A T A T T T G C C A T G A A | | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |