Sequence ID | >WENV170645916 |
Genome ID | JQGF01000550 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 462 |
End posion on genome | 387 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttgataagct |
tRNA gene sequence |
GGGGACTTAGCTTAGTTGGTAGAGCGCCTGCTTTGCACGCAGGAGGTCAGGAGTTCGACT |
Downstream region at tRNA end position |
tcacattgca |
Secondary structure (Cloverleaf model) | >WENV170645916 Ala TGC t ACCA tcacattgca G - C G - C G + T G - C A - T C - G T - A T C T T C C T C A T G A A | | | | | G T T T C G A G G A G C G + | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |