Sequence ID | >WENV170645917 |
Genome ID | JQGF01000551 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 70 |
End posion on genome | 146 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
atgtatctga |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCACAAGTTCAAG |
Downstream region at tRNA end position |
ctactgacga |
Secondary structure (Cloverleaf model) | >WENV170645917 Ile GAT a ACCA ctactgacga G - C G - C G - C T - A C - G T - A G - C T G T T G T T C A T G A A | | | | | A T C T C G A C A A G C G | | | | T T G G A G C T T A A GGGTC C - G A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |