Sequence ID | >WENV170645919 |
Genome ID | JQGF01000576 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 9547 |
End posion on genome | 9623 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcttcaccgc |
tRNA gene sequence |
AGGCGGTTAGCTCAGTTGGTTAGAGCGCTACGTTGACATCGTAGAGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
gaatacatgc |
Secondary structure (Cloverleaf model) | >WENV170645919 Val GAC c ACCA gaatacatgc A - T G - C G - C C - G G + T G - C T - A T A T T G A C C A T G A A + | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |