Sequence ID | >WENV170645926 |
Genome ID | JQGF01000881 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 1670 |
End posion on genome | 1745 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
agtacacgtt |
tRNA gene sequence |
GGCCTGGTAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTTGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
agaattcaag |
Secondary structure (Cloverleaf model) | >WENV170645926 Phe GAA t ACCA agaattcaag G - C G - C C - G C - G T - A G - C G - C T T T C C G C C A T G A A | | + | | G C C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G + T A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |