Sequence ID | >WENV170645939 |
Genome ID | JQGF01001231 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 687 |
End posion on genome | 614 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acggggtcac |
tRNA gene sequence |
GGCCTGATGGCGGAGTGGTGACGCAGAGGACTGCAAATCCTTGCACCCGGGTTCGATTCC |
Downstream region at tRNA end position |
tcgcgatgaa |
Secondary structure (Cloverleaf model) | >WENV170645939 Cys GCA c TCCA tcgcgatgaa G - C G - C C - G C - G T - A G - C A - T T T T G G C C C A G A G | | | | | G T G G C G C C G G G C G | | | T T G A C G C T G A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |