Sequence ID | >WENV170645946 |
Genome ID | JQGF01001469 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 9947 |
End posion on genome | 10020 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
agaaaagtct |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGAAGCCTTCCAAGCTTAAGACGAGGGTTCGATCCC |
Downstream region at tRNA end position |
gtttttatgt |
Secondary structure (Cloverleaf model) | >WENV170645946 Gly TCC t TCCA gtttttatgt G - C C - G G - C G - C G - C T - A G - C C T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A AGAC G A A - T A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |