Sequence ID | >WENV170645948 |
Genome ID | JQGF01001491 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 264 |
End posion on genome | 172 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgtgttgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGGCGGTTTGCTAAACCGTTATAGGATGTCAAGTC |
Downstream region at tRNA end position |
gctttccctg |
Secondary structure (Cloverleaf model) | >WENV170645948 Ser GCT c GCCA gctttccctg G - C G - C A - T G - C A C G - C G - C T A T T A C C C A T G A G + | | | | G G G C C G G T G G G C G | | | T T C A G G C C G A G TATAGGATGTCAAGTCCTATC G + T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |