Sequence ID | >WENV170645953 |
Genome ID | JQGF01001981 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 243 |
End posion on genome | 159 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgcagtcaga |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCATGGTTCAGGTCCATGTGCCGCAAGGTGTGGA |
Downstream region at tRNA end position |
aattcctcga |
Secondary structure (Cloverleaf model) | >WENV170645953 Leu CAG a ACCA aattcctcga G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGCCGCAAGGTGT C - G A - T T - A G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |