Sequence ID | >WENV170645955 |
Genome ID | JQGF01002014 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 13725 |
End posion on genome | 13650 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tctttgctgg |
tRNA gene sequence |
TCCCCGATAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGTCCCAGGTTCGAGC |
Downstream region at tRNA end position |
cttatacaaa |
Secondary structure (Cloverleaf model) | >WENV170645955 Asn GTT g GCCA cttatacaaa T - A C - G C - G C - G C - G G - C A - T C G T G G T C C A T G A A | | | | | G C C T C G C C A G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |