Sequence ID | >WENV170645958 |
Genome ID | JQGF01002026 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 2632 |
End posion on genome | 2708 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttttcttagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCGAGTTCGAA |
Downstream region at tRNA end position |
aaaaattcaa |
Secondary structure (Cloverleaf model) | >WENV170645958 Pro TGG t ACCA aaaaattcaa C - G G - C G - C G - C G - C C - G G - C T A T C G C C C A C G A A | | | | G C C G C G G C G A G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |