Sequence ID | >WENV170645970 |
Genome ID | JQGF01002417 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 207 |
End posion on genome | 282 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaaaacagtg |
tRNA gene sequence |
GTGACCGTAGCTCAGTTGGTAGAGTCCCGGATTGTGATTCCGGTTGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
aaatttctct |
Secondary structure (Cloverleaf model) | >WENV170645970 His GTG g CCCA aaatttctct G - C T - A G - C A - T C - G C - G G - C C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | + T T G G A G T T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |