Sequence ID | >WENV170645972 |
Genome ID | JQGF01002472 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 1369 |
End posion on genome | 1296 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caaaacagaa |
tRNA gene sequence |
GGCGCGGTGACAGATTGGTTATGTGATGGATTGCAAATCCGTCCAGGTTGGTTCGATTCC |
Downstream region at tRNA end position |
cttacttaca |
Secondary structure (Cloverleaf model) | >WENV170645972 Cys GCA a TCCA cttacttaca G - C G - C C - G G - C C - G G - C G - C T T T C G A C C A T A G | + | | | G T G A C A G T T G G C G | | | T T G A T G T T T G CCAG A - T T + G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |