Sequence ID | >WENV170645976 |
Genome ID | JQGF01002816 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 2906 |
End posion on genome | 2831 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tcttaggtta |
tRNA gene sequence |
GCCGATGTAGCTCAGTCGGTAGAGCAGCTCATTCGTAATGAGAAGGTCGAGGGTTCGATT |
Downstream region at tRNA end position |
gctaatctaa |
Secondary structure (Cloverleaf model) | >WENV170645976 Thr CGT a ACCA gctaatctaa G - C C - G C - G G - C A - T T - A G - C T T T T T T C C A T G A A + | + | | G C C T C G G A G G G C G | | | | T T G G A G C T A A AGGTC G A C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |