Sequence ID | >WENV170645980 |
Genome ID | JQGF01003102 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 136 |
End posion on genome | 61 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgatgccggg |
tRNA gene sequence |
GCCGCTTTAGCTCAGCTGGTAGAGCACCTCATTCGTAATGAGGGGGTCAGGTGTTCGAGT |
Downstream region at tRNA end position |
ccttttctct |
Secondary structure (Cloverleaf model) | >WENV170645980 Thr CGT g ACCA ccttttctct G - C C - G C - G G - C C - G T - A T - A T G T T C C A C A C G A A | | | | | G T C T C G A G G T G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |