Sequence ID | >WENV170645983 |
Genome ID | JQGF01003217 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 549 |
End posion on genome | 622 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caaaacaaaa |
tRNA gene sequence |
GGCGTGGTGACAGATTGGCTATGTGACGGACTGCAAATCCGTTCAGGTTGGTTCGATTCC |
Downstream region at tRNA end position |
tcttgcttgc |
Secondary structure (Cloverleaf model) | >WENV170645983 Cys GCA a TCCA tcttgcttgc G - C G - C C - G G - C T - A G - C G A T T T C G A C C A T A G | + | | | G T G A C A G T T G G C G | | | T T G A T G T C T G TCAG A - T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |