Sequence ID | >WENV170645984 |
Genome ID | JQGF01003563 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 84 |
End posion on genome | 158 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gaagatgatt |
tRNA gene sequence |
GCTCTTATAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCTCGAGTTCAAATC |
Downstream region at tRNA end position |
gattacagtt |
Secondary structure (Cloverleaf model) | >WENV170645984 Thr GGT t TCCA gattacagtt G - C C - G T - A C - G T - A T - A A - T T A T A G C T C A G A A | | | | | A T C T C G T C G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |