Sequence ID | >WENV170645991 |
Genome ID | JQGF01003910 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 313 |
End posion on genome | 237 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gcaccgctgc |
tRNA gene sequence |
GGAGCGGTAGTTCAGTTGGTTAGAATACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
aaaattacga |
Secondary structure (Cloverleaf model) | >WENV170645991 Asp GTC c GCCA aaaattacga G - C G - C A - T G - C C - G G - C G - C C G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |