Sequence ID | >WENV170645993 |
Genome ID | JQGF01004088 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 101 |
End posion on genome | 176 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggcgggccac |
tRNA gene sequence |
GCCGGTTTAGCTCAGCTGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGCGGGTTCGATT |
Downstream region at tRNA end position |
ccctctcccg |
Secondary structure (Cloverleaf model) | >WENV170645993 Thr TGT c ACCA ccctctcccg G - C C - G C - G G - C G - C T - A T - A T T T C G T C C A C G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |