Sequence ID | >WENV170645995 |
Genome ID | JQGF01004522 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 3529 |
End posion on genome | 3605 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctttttccgg |
tRNA gene sequence |
CGCGGGGTGGAGCAGCATGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ctacaccgga |
Secondary structure (Cloverleaf model) | >WENV170645995 Met CAT g ACCA ctacaccgga C A G - C C - G G - C G - C G - C G - C T A T C G T C C A C G A G | + | | | A A C G A G G T A G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |