Sequence ID | >WENV170645997 |
Genome ID | JQGF01005050 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 483 |
End posion on genome | 408 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cttactctgc |
tRNA gene sequence |
AGGCTAGTAGTTCAATTGGTAGAGCGTCGGTCTCCAAAACCGAATGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
cttttttcgt |
Secondary structure (Cloverleaf model) | >WENV170645997 Trp CCA c GCCA cttttttcgt A - T G - C G - C C - G T + G A - T G - C T G T C T C C C A T A A A | + | | | G T C T T G G G G G G C G | | + | T T G G A G C T A G ATGTT T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |