Sequence ID | >WENV170646001 |
Genome ID | JQGF01005698 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 3462 |
End posion on genome | 3387 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcatcaattc |
tRNA gene sequence |
GCCGGCTTAGCTCAGTTGGTAGAGCAGCGCACTTGTAATGCGAAGGTCGAGGGTTCAACT |
Downstream region at tRNA end position |
cgaatatcag |
Secondary structure (Cloverleaf model) | >WENV170646001 Thr TGT c ACCA cgaatatcag G - C C - G C - G G - C G - C C - G T - A T C T T T T C C A T G A A + | + | | A T C T C G G A G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |