Sequence ID | >WENV170646002 |
Genome ID | JQGF01005710 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 494 |
End posion on genome | 568 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tcagtgaccc |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGTCGGCAGTTCAATCC |
Downstream region at tRNA end position |
cactgacccc |
Secondary structure (Cloverleaf model) | >WENV170646002 Thr GGT c ACCA cactgacccc G - C C - G C - G G - C C - G C - G G - C C T T C C G T C A G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T T C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |