Sequence ID | >WENV170646003 |
Genome ID | JQGF01005796 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 937 |
End posion on genome | 1011 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgggcgatgc |
tRNA gene sequence |
GTTGGTGTAGCTCAACAGGTAGAGCGGCGGTCTCCAAAACCGCAGGAGAGGGTTCGAGTC |
Downstream region at tRNA end position |
ccgcttctac |
Secondary structure (Cloverleaf model) | >WENV170646003 Trp CCA c GCCA ccgcttctac G - C T T T T G - C G - C T - A G - C T G T C T T C C A C A A A | | + | | G A C T C G G A G G G C G | | | | T T G G A G C T A G AGGA G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |