Sequence ID | >WENV170646004 |
Genome ID | JQGF01005879 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 6959 |
End posion on genome | 6885 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gattggctta |
tRNA gene sequence |
GCGACCGTAGTTCAATGGATAGAATTAGAGTTTCCGAAGCTCTCGATACAGGTTCGATTC |
Downstream region at tRNA end position |
gatgcaatag |
Secondary structure (Cloverleaf model) | >WENV170646004 Arg CCG a GCCA gatgcaatag G - C C - G G - C A - T C - G C - G G - C T T T T G T C C A T A A A | | | | | G G C T T G A C A G G C G | | | + T T A G A A T T A T CGAT A - T G - C A - T G - C T + G T A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |