Sequence ID | >WENV170646013 |
Genome ID | JQGF01006587 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 5283 |
End posion on genome | 5367 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttagtttgaa |
tRNA gene sequence |
GCCGACGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTACG |
Downstream region at tRNA end position |
aaaacaagca |
Secondary structure (Cloverleaf model) | >WENV170646013 Leu GAG a ACCA aaaacaagca G - C C - G C - G G - C A - T C - G G - C T G T T G C T C A T A A G | | | | | G T G G T G A C G A G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |