Sequence ID | >WENV170646017 |
Genome ID | JQGF01007411 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 529 |
End posion on genome | 455 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
cgacgaattc |
tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTAGAGCACTGCTTTCACACGGCAGGGGTCACAAGTTCGAAAC |
Downstream region at tRNA end position |
gttccagcga |
Secondary structure (Cloverleaf model) | >WENV170646017 Val CAC c ACCA gttccagcga G - C G - C G - C C - G G - C G - C T - A A A T T G T T C A G A A | | | | | G C C T C G A C A A G C G | | | | T T G G A G C T A A GGGTC C - G T - A G - C C - G T + G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |