Sequence ID | >WENV170646020 |
Genome ID | JQGF01008573 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 430 |
End posion on genome | 354 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cctcccgctc |
tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCGGTCCCCTCCTAAGGGACAGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
ttccctgccc |
Secondary structure (Cloverleaf model) | >WENV170646020 Arg CCT c GCCA ttccctgccc G - C G - C C - G C - G C - G C - G G - C T A T T G T G C A C G A A + | | | | G T C T C G G C A C G C G | | | | T T G G A G C A T A G AGGTC G - C T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |