Sequence ID | >WENV170646021 |
Genome ID | JQGF01008890 |
Phylum/Class | [JQGF] wastewater metagenome; domestic wastewater sediment treated with ammonia and hydroxylamine at 100mg /litre each |
Species | |
Start position on genome | 524 |
End posion on genome | 599 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ccgagacctc |
tRNA gene sequence |
GGGGCTATAGCTCAGTTGGTAGAGCGCTTGAATGGCATTCAAGAGGTCAGCGGTTCGACT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646021 Ala GGC c ACCA nnnnnnnnnn G - C G - C G + T G - C C - G T - A A - T T C T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |